Molecular characterization of Hepcidin (HAMP gene exon2 ) Gene in Selected Iron Deficiency Anemia Patients from Basrah Governorate, Iraq
Main Article Content
Abstract
Anemia constitutes one of the most common blood diseases, which can be dangerous and more complex than it appears. This danger comes from the apparent lack of iron which is a vital element in various metabolic and anabolic processes. The HAMP gene produces a protein called Hepcidin, which has a very important role in iron metabolism. This study aimed at the molecular detection of HAMP gene in selected iron deficiency anemia patients, as well as healthy control, from Basra community in the south of Iraq. Forty five samples were collected from private clinics, which were divided into 33 samples for affected patients and 12 samples represented the control group. A1768 bp fragment containing HAMP exon 2was amplified using Forward: GTGGGACTTGGGGATAAGGC and Reverse: GGGCCTTGCTTTCTTGCTTC . four different polymorphisms were obtained depending on the number of mutations that occurred for the gene compared to what was recorded in the GenBank for the same gene, 3 polymorphisms, studies represented the affected and 1 represented the control, they were all registered in the GenBank under accession numbers LC713271, LC713271, LC713273, (patients’ samples), and LC713274, (control samples). The polymorphisms obtained in the current study had a number of different mutations, whether silent or missense, some mutations occurred in more than one polymorphism, while some occurred in one polymorphism. It was noted that some mutations occurred in all polymorphisms of the study. When conducting a BLAST analysis, it was found that the results obtained were closer to each of the genes recorded in America and China, and this can be clearly observed in the analysis of the phylogenetic tree. The results of the analysis of the three-dimensional structure of the expected protein indicated a great match between the polymorphisms of the study . As a result of the occurrence of these mutations, the HAMP gene in Iraq has more than one polymorphism, these polymorphisms may be associated with the function of the gene. Therefore, further studies are needed to link this polymorphism to various traits associated with anemia.